generation lentiviral packaging plasmids pmd2 g (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
generation lentiviral packaging plasmids pmd2 g
Generation Lentiviral Packaging Plasmids Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generation+lentiviral+packaging+plasmids+pmd2+g/PJ14+(Plasmid+%2325912)/pm41430299-66-18-23
Average 93 stars, based on 20 article reviews
Generation Lentiviral Packaging Plasmids Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generation+lentiviral+packaging+plasmids+pmd2+g/PJ14+(Plasmid+%2325912)/pm41430299-66-18-23
Average 93 stars, based on 20 article reviews
generation lentiviral packaging plasmids pmd2 g - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Generated:Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer. Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’- C C G G G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C T T T T T G-3’ (F) and 5’- A A T T C A A A A A G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’-CCGGGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTCTTTTTG-3’ (F) and 5’- AATTCAAAAAGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTC-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1-shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Transfection:Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer. Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’- C C G G G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C T T T T T G-3’ (F) and 5’- A A T T C A A A A A G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Article Title: NAD + supplement potentiates tumor-killing function by rescuing defective TUB-mediated NAMPT transcription in tumor-infiltrated T cells. Article Snippet: .. Cells were then transfected with sgRNA transfer plasmids, along with 2nd Article Title: Interaction networks of Weibel-Palade body regulators syntaxin-3 and syntaxin binding protein 5 in endothelial cells. Article Snippet: HEK293T cells were obtained from ATCC (Wessel, Germany) and were grown in Dulbecco's modified Eagle medium containing D-glucose, L-glutamine, and pyruvate (Life Technologies, Bleiswijk, The Netherlands) supplemented with 10% FCS, 100 U/m penicillin, and 100mg/ml streptomycin. .. Lentivirus was produced in HEK293Ts using CaCl2 mediated transfection of the lentiviral constructs (described above) together with 3rd Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’-CCGGGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTCTTTTTG-3’ (F) and 5’- AATTCAAAAAGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTC-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1-shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd shRNA:Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer. Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’- C C G G G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C T T T T T G-3’ (F) and 5’- A A T T C A A A A A G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’-CCGGGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTCTTTTTG-3’ (F) and 5’- AATTCAAAAAGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTC-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1-shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Plasmid Preparation:Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer. Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’- C C G G G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C T T T T T G-3’ (F) and 5’- A A T T C A A A A A G A G G A G C T G C C C T T G T T T C T T C T C G A G A A G A A A C A A G G G C A G C T C C T C-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls Article Snippet: EBNA1 AA1-641 and AA2-89, and the ECD of GlialCAM (ECD, AA34-240), were expressed in Freestyle 293-F cells (Thermo Fisher Scientific R79007) using second-generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector ( ) and cotransfected into HEK293T cells with Article Title: AP-1 transcription factors and the SWI/SNF complex mediate signal-dependent enhancer selection Article Snippet: ATAC libraries were generated as previously described ( Buenrostro et al., 2013 ) using nuclei from 40,000 MEFs per sample and sequenced on the Illumina NextSeq 500 platform with 75 bp single-end reads. .. Infectious lentiviral particles were produced in HEK293T cells using the third Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls. Article Snippet: EBNA1 AA1- 641 and AA2- 89, and the ECD of GlialCAM (ECD, AA34- 240), were expressed in Freestyle 293- F cells (Thermo Fisher Scientific R79007) using second- generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector (50) and cotransfected into HEK293T cells with second- Article Title: Multi-omics reveals FAT10 as an immunometabolic survival factor rewiring global metabolism in cancer Article Snippet: The following oligomers were annealed and cloned into the pLKO.1-TRC vector (Addgene plasmid #10,878) for synthesis of the pLKO.1-shFAT10 construct: 5’-CCGGGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTCTTTTTG-3’ (F) and 5’- AATTCAAAAAGAGGAGCTGCCCTTGTTTCTTCTCGAGAAGAAACAAGGGCAGCTCCTC-3’ (R). .. Lentiviruses were generated via transfection of pLKO.1-shFAT10 or scramble shRNA vector (Addgene plasmid #1864), together with the 3rd Construct:Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. The following day, 293T cells were co-transfected with lentiCRISPR v2 construct and the Article Title: Interaction networks of Weibel-Palade body regulators syntaxin-3 and syntaxin binding protein 5 in endothelial cells. Article Snippet: HEK293T cells were obtained from ATCC (Wessel, Germany) and were grown in Dulbecco's modified Eagle medium containing D-glucose, L-glutamine, and pyruvate (Life Technologies, Bleiswijk, The Netherlands) supplemented with 10% FCS, 100 U/m penicillin, and 100mg/ml streptomycin. .. Lentivirus was produced in HEK293Ts using CaCl2 mediated transfection of the lentiviral constructs (described above) together with 3rd Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls Article Snippet: EBNA1 AA1-641 and AA2-89, and the ECD of GlialCAM (ECD, AA34-240), were expressed in Freestyle 293-F cells (Thermo Fisher Scientific R79007) using second-generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector ( ) and cotransfected into HEK293T cells with Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls. Article Snippet: EBNA1 AA1- 641 and AA2- 89, and the ECD of GlialCAM (ECD, AA34- 240), were expressed in Freestyle 293- F cells (Thermo Fisher Scientific R79007) using second- generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector (50) and cotransfected into HEK293T cells with second- Produced:Article Title: Interaction networks of Weibel-Palade body regulators syntaxin-3 and syntaxin binding protein 5 in endothelial cells. Article Snippet: HEK293T cells were obtained from ATCC (Wessel, Germany) and were grown in Dulbecco's modified Eagle medium containing D-glucose, L-glutamine, and pyruvate (Life Technologies, Bleiswijk, The Netherlands) supplemented with 10% FCS, 100 U/m penicillin, and 100mg/ml streptomycin. .. Lentivirus was produced in HEK293Ts using CaCl2 mediated transfection of the lentiviral constructs (described above) together with 3rd Article Title: AP-1 transcription factors and the SWI/SNF complex mediate signal-dependent enhancer selection Article Snippet: ATAC libraries were generated as previously described ( Buenrostro et al., 2013 ) using nuclei from 40,000 MEFs per sample and sequenced on the Illumina NextSeq 500 platform with 75 bp single-end reads. .. Infectious lentiviral particles were produced in HEK293T cells using the third Clone Assay:Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls Article Snippet: EBNA1 AA1-641 and AA2-89, and the ECD of GlialCAM (ECD, AA34-240), were expressed in Freestyle 293-F cells (Thermo Fisher Scientific R79007) using second-generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector ( ) and cotransfected into HEK293T cells with Article Title: Antibody reactivity against EBNA1 and GlialCAM differentiates multiple sclerosis patients from healthy controls. Article Snippet: EBNA1 AA1- 641 and AA2- 89, and the ECD of GlialCAM (ECD, AA34- 240), were expressed in Freestyle 293- F cells (Thermo Fisher Scientific R79007) using second- generation lentiviral transduction. .. Briefly, constructs were cloned into a custom lentiviral vector (50) and cotransfected into HEK293T cells with second- |